Transcript: Mouse XM_006538033.1

PREDICTED: Mus musculus FK506 binding protein 15 (Fkbp15), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fkbp15 (338355)
Length:
4354
CDS:
169..3789

Additional Resources:

NCBI RefSeq record:
XM_006538033.1
NBCI Gene record:
Fkbp15 (338355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346921 CCGCTACATAAATGGTCAATA pLKO_005 414 CDS 100% 13.200 18.480 N Fkbp15 n/a
2 TRCN0000346923 GCTAATGGTTCGGCCCAATAA pLKO_005 558 CDS 100% 13.200 18.480 N Fkbp15 n/a
3 TRCN0000346922 CAGCCAGCTCATCCGGTATTA pLKO_005 1399 CDS 100% 13.200 9.240 N Fkbp15 n/a
4 TRCN0000346924 GAAAGGAGGAAAGCGCTTAAT pLKO_005 912 CDS 100% 13.200 9.240 N Fkbp15 n/a
5 TRCN0000346992 TGGTTCAGGGCTCTGAGTTAG pLKO_005 3902 3UTR 100% 10.800 7.560 N Fkbp15 n/a
6 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 2930 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.