Transcript: Mouse XM_006538045.2

PREDICTED: Mus musculus major urinary protein 20 (Mup20), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mup20 (381530)
Length:
718
CDS:
95..640

Additional Resources:

NCBI RefSeq record:
XM_006538045.2
NBCI Gene record:
Mup20 (381530)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105481 GTAACGTATGATGGATCGAAT pLKO.1 395 CDS 100% 4.950 6.930 N Mup20 n/a
2 TRCN0000105482 CCTTAGCTCTTAAATTCCATA pLKO.1 303 CDS 100% 4.950 2.970 N Mup20 n/a
3 TRCN0000270940 ACTTAAGACAGACTATGATAA pLKO_005 427 CDS 100% 13.200 6.600 Y Mup6 n/a
4 TRCN0000284694 CTATGGCCGAGAACCAGATTT pLKO_005 508 CDS 100% 13.200 6.600 Y Mup7 n/a
5 TRCN0000105483 GTTCTATGGAAAGGAACTTTA pLKO.1 162 CDS 100% 13.200 6.600 Y Mup20 n/a
6 TRCN0000272268 TATGGCCGAGAACCAGATTTG pLKO_005 509 CDS 100% 10.800 5.400 Y Mup8 n/a
7 TRCN0000272250 CCATGCAGAAGAAGCTAGTTC pLKO_005 145 CDS 100% 4.950 2.475 Y Mup9 n/a
8 TRCN0000105484 GAGCATGGAATCGTTAGAGAA pLKO.1 569 CDS 100% 4.950 2.475 Y Mup20 n/a
9 TRCN0000105446 GCCGAGAACCAGATTTGAGTT pLKO.1 513 CDS 100% 4.950 2.475 Y Mup1 n/a
10 TRCN0000105463 TCCATGCAGAAGAAGCTAGTT pLKO.1 144 CDS 100% 4.950 2.475 Y Mup2 n/a
11 TRCN0000105445 CCCTTCCTATCCATACAGCAT pLKO.1 699 3UTR 100% 2.640 1.320 Y Mup1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.