Transcript: Mouse XM_006538127.3

PREDICTED: Mus musculus Fanconi anemia, complementation group G (Fancg), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Fancg (60534)
Length:
2904
CDS:
386..2257

Additional Resources:

NCBI RefSeq record:
XM_006538127.3
NBCI Gene record:
Fancg (60534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538127.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088041 CCGGGTCTCTTCCACTGTATT pLKO.1 2145 CDS 100% 13.200 9.240 N Fancg n/a
2 TRCN0000309289 CCGGGTCTCTTCCACTGTATT pLKO_005 2145 CDS 100% 13.200 9.240 N Fancg n/a
3 TRCN0000305367 GGATCTGCTACTACTGCTAAA pLKO_005 925 CDS 100% 10.800 7.560 N Fancg n/a
4 TRCN0000088040 GCACTGTTGTACTTGACTGAA pLKO.1 1193 CDS 100% 4.950 3.465 N Fancg n/a
5 TRCN0000331923 GCACTGTTGTACTTGACTGAA pLKO_005 1193 CDS 100% 4.950 3.465 N Fancg n/a
6 TRCN0000088038 CCAGCTTGTTAGACAGGCTAA pLKO.1 460 CDS 100% 4.050 2.835 N Fancg n/a
7 TRCN0000088042 CCAGTGTCTTGAGCTGCTCTT pLKO.1 1831 CDS 100% 4.050 2.835 N Fancg n/a
8 TRCN0000309357 CCAGTGTCTTGAGCTGCTCTT pLKO_005 1831 CDS 100% 4.050 2.835 N Fancg n/a
9 TRCN0000088039 CCTTGCTGTTACAAACCCTAA pLKO.1 879 CDS 100% 4.050 2.835 N Fancg n/a
10 TRCN0000309290 CCTTGCTGTTACAAACCCTAA pLKO_005 879 CDS 100% 4.050 2.835 N Fancg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538127.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.