Transcript: Mouse XM_006538142.3

PREDICTED: Mus musculus sushi domain containing 1 (Susd1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Susd1 (634731)
Length:
4085
CDS:
660..2843

Additional Resources:

NCBI RefSeq record:
XM_006538142.3
NBCI Gene record:
Susd1 (634731)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538142.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347740 TCGCTAATATTTCGGTATATA pLKO_005 2161 CDS 100% 15.000 21.000 N Susd1 n/a
2 TRCN0000347660 CCGCTACTGATTACACGATAA pLKO_005 2062 CDS 100% 10.800 15.120 N Susd1 n/a
3 TRCN0000347737 CTCCGCACAAATAACCATAAC pLKO_005 2114 CDS 100% 10.800 15.120 N Susd1 n/a
4 TRCN0000347738 GTACTTGATACGCGTTGAAAG pLKO_005 1652 CDS 100% 10.800 15.120 N Susd1 n/a
5 TRCN0000347736 CATGACCTCATTCCTGAATTT pLKO_005 3000 3UTR 100% 13.200 9.240 N Susd1 n/a
6 TRCN0000055469 CCTGTGTGAGATGGCAAATAA pLKO.1 1603 CDS 100% 15.000 9.000 N SUSD1 n/a
7 TRCN0000055471 GCACAGAAATAGACTGTGGTA pLKO.1 1195 CDS 100% 0.264 0.185 N SUSD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538142.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.