Transcript: Mouse XM_006538200.3

PREDICTED: Mus musculus RIKEN cDNA 2610301B20 gene (2610301B20Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
2610301B20Rik (67157)
Length:
2145
CDS:
365..772

Additional Resources:

NCBI RefSeq record:
XM_006538200.3
NBCI Gene record:
2610301B20Rik (67157)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538200.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263437 AGTATACTCCATAACTCTAAA pLKO_005 1492 3UTR 100% 13.200 18.480 N 2610301B20Rik n/a
2 TRCN0000263434 TTCGCTGGGTGTGTGGTAAAC pLKO_005 747 CDS 100% 10.800 8.640 N 2610301B20Rik n/a
3 TRCN0000200672 GCCCATTCTTTATTGAAGCAT pLKO.1 1571 3UTR 100% 3.000 2.400 N 2610301B20Rik n/a
4 TRCN0000217555 GTGAGCTACAATGACTATATG pLKO.1 566 CDS 100% 13.200 9.240 N 2610301B20Rik n/a
5 TRCN0000263435 GTGAGCTACAATGACTATATG pLKO_005 566 CDS 100% 13.200 9.240 N 2610301B20Rik n/a
6 TRCN0000192285 CAAGTCATGTGACTACCTGTT pLKO.1 592 CDS 100% 4.050 2.835 N 2610301B20Rik n/a
7 TRCN0000140950 CCAGTGTAGCTGGAGAACTAT pLKO.1 691 CDS 100% 5.625 3.938 N C8orf37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538200.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.