Transcript: Mouse XM_006538242.3

PREDICTED: Mus musculus tRNA methyltransferase 10B (Trmt10b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trmt10b (69934)
Length:
2142
CDS:
173..1129

Additional Resources:

NCBI RefSeq record:
XM_006538242.3
NBCI Gene record:
Trmt10b (69934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538242.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039160 CCATCAACCAAGTGTTCGATA pLKO.1 1008 CDS 100% 4.950 6.930 N Trmt10b n/a
2 TRCN0000308866 CCATCAACCAAGTGTTCGATA pLKO_005 1008 CDS 100% 4.950 6.930 N Trmt10b n/a
3 TRCN0000039159 CCTTAACCAAAGAGAAACTTT pLKO.1 507 CDS 100% 5.625 4.500 N Trmt10b n/a
4 TRCN0000308786 CCTTAACCAAAGAGAAACTTT pLKO_005 507 CDS 100% 5.625 4.500 N Trmt10b n/a
5 TRCN0000039163 GAAACTCGTAACTGGCCTGAA pLKO.1 1046 CDS 100% 4.050 3.240 N Trmt10b n/a
6 TRCN0000308865 GAAACTCGTAACTGGCCTGAA pLKO_005 1046 CDS 100% 4.050 3.240 N Trmt10b n/a
7 TRCN0000434644 GACAGATTCGAAGGTTGTATG pLKO_005 615 CDS 100% 10.800 7.560 N TRMT10B n/a
8 TRCN0000039162 CACTCCCTTGAAGACATTGAT pLKO.1 824 CDS 100% 5.625 3.938 N Trmt10b n/a
9 TRCN0000308867 CACTCCCTTGAAGACATTGAT pLKO_005 824 CDS 100% 5.625 3.938 N Trmt10b n/a
10 TRCN0000039161 GTCTCCTCAAAGAAGAGCAAA pLKO.1 395 CDS 100% 4.950 3.465 N Trmt10b n/a
11 TRCN0000308785 GTCTCCTCAAAGAAGAGCAAA pLKO_005 395 CDS 100% 4.950 3.465 N Trmt10b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538242.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.