Transcript: Mouse XM_006538474.3

PREDICTED: Mus musculus taste receptor, type 1, member 1 (Tas1r1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tas1r1 (110326)
Length:
2585
CDS:
286..2433

Additional Resources:

NCBI RefSeq record:
XM_006538474.3
NBCI Gene record:
Tas1r1 (110326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538474.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098831 CCCTCTAGGTTATTATGACAT pLKO.1 1239 CDS 100% 4.950 6.930 N Tas1r1 n/a
2 TRCN0000098834 CGCTTTCACGACATGGAACAT pLKO.1 1011 CDS 100% 4.950 6.930 N Tas1r1 n/a
3 TRCN0000098832 GCGGCTATTTCCTCCCTAAAT pLKO.1 2321 CDS 100% 13.200 9.240 N Tas1r1 n/a
4 TRCN0000098830 CCTCCCTAAATGCTACGTGAT pLKO.1 2331 CDS 100% 4.050 2.835 N Tas1r1 n/a
5 TRCN0000098833 CGGAGAACTATAACGAAGCCA pLKO.1 2165 CDS 100% 0.750 0.525 N Tas1r1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538474.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.