Transcript: Mouse XM_006538727.1

PREDICTED: Mus musculus zinc finger and BTB domain containing 17 (Zbtb17), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb17 (22642)
Length:
2796
CDS:
234..2693

Additional Resources:

NCBI RefSeq record:
XM_006538727.1
NBCI Gene record:
Zbtb17 (22642)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082070 CAACCTGCGTTCTCATGTAAA pLKO.1 2162 CDS 100% 13.200 18.480 N Zbtb17 n/a
2 TRCN0000416610 ACGAGACGGAAGTACTCAAAG pLKO_005 2350 CDS 100% 10.800 15.120 N Zbtb17 n/a
3 TRCN0000082072 CGTTGACTTCAAGGCTCACAA pLKO.1 329 CDS 100% 4.950 6.930 N Zbtb17 n/a
4 TRCN0000415141 GAACGCTGTGGCAAGAGATTT pLKO_005 1962 CDS 100% 13.200 10.560 N Zbtb17 n/a
5 TRCN0000425958 CAAGTTCCTGGATGCCAATAG pLKO_005 2453 CDS 100% 10.800 7.560 N Zbtb17 n/a
6 TRCN0000082069 CCTGTCCAAGCACATTATCAT pLKO.1 2081 CDS 100% 5.625 3.938 N Zbtb17 n/a
7 TRCN0000082071 CCAGTGTGTGATATGTGGTAA pLKO.1 1871 CDS 100% 4.950 3.465 N Zbtb17 n/a
8 TRCN0000012956 CGAGTACTTCAAGATGCTCTT pLKO.1 371 CDS 100% 4.050 2.835 N ZBTB17 n/a
9 TRCN0000082068 GCCCACTTGAAGATCCACATT pLKO.1 1668 CDS 100% 4.950 2.970 N Zbtb17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.