Transcript: Mouse XM_006538805.3

PREDICTED: Mus musculus vacuolar protein sorting 13D (Vps13d), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vps13d (230895)
Length:
15792
CDS:
185..13279

Additional Resources:

NCBI RefSeq record:
XM_006538805.3
NBCI Gene record:
Vps13d (230895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538805.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252564 ATGTCGTCAGCATCGGAAATT pLKO_005 3888 CDS 100% 13.200 18.480 N Vps13d n/a
2 TRCN0000252565 TCGTGGAGAATATCGAGTTAA pLKO_005 618 CDS 100% 13.200 18.480 N Vps13d n/a
3 TRCN0000252566 TACAACCCACAGGCTATTAAA pLKO_005 2096 CDS 100% 15.000 12.000 N Vps13d n/a
4 TRCN0000252567 CACACTTTCTGGAGATTATTA pLKO_005 8437 CDS 100% 15.000 10.500 N Vps13d n/a
5 TRCN0000267419 CGTCAGCGACATTGGCTATTT pLKO_005 3928 CDS 100% 13.200 9.240 N Vps13d n/a
6 TRCN0000040283 CCCAGAAAGTTCCAGATCAAA pLKO.1 6292 CDS 100% 5.625 3.938 N VPS13D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538805.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.