Transcript: Mouse XM_006538824.3

PREDICTED: Mus musculus adherens junction associated protein 1 (Ajap1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ajap1 (230959)
Length:
4265
CDS:
1881..3110

Additional Resources:

NCBI RefSeq record:
XM_006538824.3
NBCI Gene record:
Ajap1 (230959)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253239 GACATCTTCACCGCCTATAAT pLKO_005 2910 CDS 100% 15.000 21.000 N Ajap1 n/a
2 TRCN0000253238 TTCCGGTAGAGTCACTATTTC pLKO_005 3599 3UTR 100% 13.200 18.480 N Ajap1 n/a
3 TRCN0000253235 TGATACAGAGTTCAACGATTT pLKO_005 2351 CDS 100% 10.800 15.120 N Ajap1 n/a
4 TRCN0000107053 TCATCACAACTCTTGTCTTAA pLKO.1 2767 CDS 100% 13.200 9.240 N AJAP1 n/a
5 TRCN0000253236 TCATCACAACTCTTGTCTTAA pLKO_005 2767 CDS 100% 13.200 9.240 N Ajap1 n/a
6 TRCN0000253237 GCCATGCCTGGATACTGATAG pLKO_005 1939 CDS 100% 10.800 7.560 N Ajap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.