Transcript: Mouse XM_006538956.3

PREDICTED: Mus musculus forkhead-associated (FHA) phosphopeptide binding domain 1 (Fhad1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fhad1 (329977)
Length:
4682
CDS:
192..4454

Additional Resources:

NCBI RefSeq record:
XM_006538956.3
NBCI Gene record:
Fhad1 (329977)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538956.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093402 CGTCTTACAGTCCGCAGATAT pLKO.1 275 CDS 100% 13.200 18.480 N Fhad1 n/a
2 TRCN0000093401 GACATCTTTACAGAAAGACAT pLKO.1 1217 CDS 100% 0.495 0.347 N Fhad1 n/a
3 TRCN0000093400 CAGTGATGAAAGAAGAGCTAA pLKO.1 1345 CDS 100% 4.950 2.970 N Fhad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538956.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.