Transcript: Mouse XM_006539032.3

PREDICTED: Mus musculus serine/arginine repetitive matrix 1 (Srrm1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Srrm1 (51796)
Length:
5544
CDS:
2159..4681

Additional Resources:

NCBI RefSeq record:
XM_006539032.3
NBCI Gene record:
Srrm1 (51796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090565 CGCTCACCACAACCAAACAAA pLKO.1 3986 CDS 100% 5.625 7.875 N Srrm1 n/a
2 TRCN0000309550 CGCTCACCACAACCAAACAAA pLKO_005 3986 CDS 100% 5.625 7.875 N Srrm1 n/a
3 TRCN0000090566 CACCTCTACAAGTGACATCTT pLKO.1 2623 CDS 100% 4.950 6.930 N Srrm1 n/a
4 TRCN0000090564 GCCCAAGAGATCCCATGTAAA pLKO.1 3421 CDS 100% 13.200 9.240 N Srrm1 n/a
5 TRCN0000309551 GCCCAAGAGATCCCATGTAAA pLKO_005 3421 CDS 100% 13.200 9.240 N Srrm1 n/a
6 TRCN0000305336 GTTTGAGCTTTAGACTATAAC pLKO_005 4753 3UTR 100% 13.200 9.240 N Srrm1 n/a
7 TRCN0000315211 GTTTGAGCTTTAGACTATAAC pLKO_005 4753 3UTR 100% 13.200 9.240 N SRRM1 n/a
8 TRCN0000305398 AGATCCCGATCAAGATCATAC pLKO_005 2810 CDS 100% 10.800 7.560 N Srrm1 n/a
9 TRCN0000000134 GCAGTCAAACCGTACAAGAAA pLKO.1 3157 CDS 100% 5.625 3.938 N SRRM1 n/a
10 TRCN0000090567 CCACCTCTACAAGTGACATCT pLKO.1 2622 CDS 100% 4.950 3.465 N Srrm1 n/a
11 TRCN0000309617 CCACCTCTACAAGTGACATCT pLKO_005 2622 CDS 100% 4.950 3.465 N Srrm1 n/a
12 TRCN0000092022 GAAGAGATAAAGCAGAGACAA pLKO.1 2294 CDS 100% 4.950 3.465 N LOC385704 n/a
13 TRCN0000000132 CCACAACCAAACAAACGGCAT pLKO.1 3992 CDS 100% 2.160 1.512 N SRRM1 n/a
14 TRCN0000315275 CCACAACCAAACAAACGGCAT pLKO_005 3992 CDS 100% 2.160 1.512 N SRRM1 n/a
15 TRCN0000087156 GCTGAAGATGACAACCTTGAT pLKO.1 4589 CDS 100% 4.950 2.970 N Gm1246 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.