Transcript: Mouse XM_006539216.3

PREDICTED: Mus musculus filamin binding LIM protein 1 (Fblim1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fblim1 (74202)
Length:
3071
CDS:
176..1303

Additional Resources:

NCBI RefSeq record:
XM_006539216.3
NBCI Gene record:
Fblim1 (74202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295097 GTGCTGCCCTGACATGTTTAT pLKO_005 1553 3UTR 100% 13.200 9.240 N Fblim1 n/a
2 TRCN0000295098 TGTGCAGCATCTGCGAGAATC pLKO_005 1086 CDS 100% 10.800 7.560 N Fblim1 n/a
3 TRCN0000295099 CCATCAAAGGGATCGTCTGTC pLKO_005 608 CDS 100% 4.050 2.835 N Fblim1 n/a
4 TRCN0000098759 CAGAGATTCTACCAGAAGGAT pLKO.1 842 CDS 100% 3.000 2.100 N Fblim1 n/a
5 TRCN0000287680 CAGAGATTCTACCAGAAGGAT pLKO_005 842 CDS 100% 3.000 2.100 N Fblim1 n/a
6 TRCN0000098756 GCTGATTTCTACAGGAAATTT pLKO.1 1058 CDS 100% 1.500 1.050 N Fblim1 n/a
7 TRCN0000287679 GCTGATTTCTACAGGAAATTT pLKO_005 1058 CDS 100% 1.500 1.050 N Fblim1 n/a
8 TRCN0000098757 TGGCTGATTTCTACAGGAAAT pLKO.1 1056 CDS 100% 1.080 0.756 N Fblim1 n/a
9 TRCN0000098758 GCCTCCTGTCTTACCAGGGAA pLKO.1 520 CDS 100% 0.880 0.528 N Fblim1 n/a
10 TRCN0000098755 CCAGAGTTCATTTCCCAGCAT pLKO.1 1982 3UTR 100% 2.640 1.320 Y Fblim1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2648 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.