Transcript: Mouse XM_006539928.3

PREDICTED: Mus musculus fukutin related protein (Fkrp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fkrp (243853)
Length:
2859
CDS:
191..1675

Additional Resources:

NCBI RefSeq record:
XM_006539928.3
NBCI Gene record:
Fkrp (243853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539928.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436786 TAGTGGATGAACGCGGCTTTG pLKO_005 1347 CDS 100% 6.000 8.400 N Fkrp n/a
2 TRCN0000427142 CCTTGGGACTACGACGTAGAT pLKO_005 1262 CDS 100% 4.950 6.930 N Fkrp n/a
3 TRCN0000426397 CTACGTAGCCACCGAGTTTGT pLKO_005 547 CDS 100% 4.950 6.930 N Fkrp n/a
4 TRCN0000430932 GCATAGTCTCTGCCCTATATT pLKO_005 1959 3UTR 100% 15.000 12.000 N Fkrp n/a
5 TRCN0000125398 CATCCTCAACCTCCTAGTCTT pLKO.1 232 CDS 100% 4.950 3.465 N Fkrp n/a
6 TRCN0000125395 CCAGAGCTAGTGGATTCCTTT pLKO.1 380 CDS 100% 4.950 3.465 N Fkrp n/a
7 TRCN0000125394 CCAGTCTGTTTCATTTGAGAT pLKO.1 2079 3UTR 100% 4.950 3.465 N Fkrp n/a
8 TRCN0000125396 CGACTTCTTCCGAGTACAGTA pLKO.1 1390 CDS 100% 4.950 3.465 N Fkrp n/a
9 TRCN0000125397 CCTGCCCTTTGCGGGTTTCAT pLKO.1 1543 CDS 100% 1.875 1.313 N Fkrp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539928.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.