Transcript: Mouse XM_006540003.3

PREDICTED: Mus musculus pregnancy specific glycoprotein 18 (Psg18), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Psg18 (26438)
Length:
1537
CDS:
223..1437

Additional Resources:

NCBI RefSeq record:
XM_006540003.3
NBCI Gene record:
Psg18 (26438)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065823 GCTGTACTACTATAGTGTAAT pLKO.1 468 CDS 100% 13.200 18.480 N Psg18 n/a
2 TRCN0000065824 CTACCCTTATATCTCCGACTA pLKO.1 677 CDS 100% 4.050 5.670 N Psg18 n/a
3 TRCN0000065827 CGAGGAGAAATAGTATCAAAT pLKO.1 604 CDS 100% 13.200 9.240 N Psg18 n/a
4 TRCN0000065825 CCCAAGTGTATGAAGGAGAAA pLKO.1 350 CDS 100% 4.950 3.465 N Psg18 n/a
5 TRCN0000065826 GCATTTAACAAGGTTGAGATT pLKO.1 802 CDS 100% 4.950 2.970 N Psg18 n/a
6 TRCN0000065530 CCAGAAGATGTGCAAACCTTT pLKO.1 1120 CDS 100% 4.950 2.475 Y Psg19 n/a
7 TRCN0000065773 CCAGAGAATCTTCTAGTGTTT pLKO.1 397 CDS 100% 4.950 2.475 Y Psg28 n/a
8 TRCN0000177597 CCAGAGAATCTTCTAGTGTTT pLKO.1 397 CDS 100% 4.950 2.475 Y Psg26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.