Transcript: Mouse XM_006540077.1

PREDICTED: Mus musculus catsper channel auxiliary subunit gamma 1 (Catsperg1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Catsperg1 (320225)
Length:
5868
CDS:
185..5728

Additional Resources:

NCBI RefSeq record:
XM_006540077.1
NBCI Gene record:
Catsperg1 (320225)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266771 GTCTCATTCAGACCCTAATAA pLKO_005 5829 3UTR 100% 15.000 7.500 Y Catsperg2 n/a
2 TRCN0000266767 ATAGCCAAGGACCCACTATTA pLKO_005 4698 CDS 100% 13.200 6.600 Y Catsperg2 n/a
3 TRCN0000266769 TATCAAGGCCTCGTCTATTAC pLKO_005 4394 CDS 100% 13.200 6.600 Y Catsperg2 n/a
4 TRCN0000266770 GATGTCTCCTACACGATTATG pLKO_005 5021 CDS 100% 13.200 6.600 Y Catsperg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.