Transcript: Mouse XM_006540275.3

PREDICTED: Mus musculus zinc finger protein 110 (Zfp110), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp110 (65020)
Length:
3213
CDS:
311..2809

Additional Resources:

NCBI RefSeq record:
XM_006540275.3
NBCI Gene record:
Zfp110 (65020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329648 CTCTAAAGAGAGTATACTTAT pLKO_005 1831 CDS 100% 13.200 9.240 N Zfp110 n/a
2 TRCN0000329579 GACACATGCCTTACCTGTAAA pLKO_005 2017 CDS 100% 13.200 9.240 N Zfp110 n/a
3 TRCN0000329646 AGATGTATCTCTGACGTTTAC pLKO_005 373 CDS 100% 10.800 7.560 N Zfp110 n/a
4 TRCN0000329580 CTGTCTTTGAAAGTATCTTAG pLKO_005 1395 CDS 100% 10.800 6.480 N Zfp110 n/a
5 TRCN0000095461 GCAGCCCAATACACGTTCAAA pLKO.1 883 CDS 100% 5.625 3.375 N Zfp110 n/a
6 TRCN0000095460 GCCCTGATTCAATCCCTCTAT pLKO.1 698 CDS 100% 4.950 2.475 Y Zfp110 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.