Transcript: Mouse XM_006540324.3

PREDICTED: Mus musculus EPS8-like 1 (Eps8l1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eps8l1 (67425)
Length:
4014
CDS:
310..2460

Additional Resources:

NCBI RefSeq record:
XM_006540324.3
NBCI Gene record:
Eps8l1 (67425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098258 GAGGGCTATGTACCCTATAAT pLKO.1 1876 CDS 100% 15.000 21.000 N Eps8l1 n/a
2 TRCN0000098257 CCAAGTGCAAAGTCTATCTAT pLKO.1 346 CDS 100% 5.625 3.938 N Eps8l1 n/a
3 TRCN0000098259 AGTCTATCTATGAACAGAGAA pLKO.1 356 CDS 100% 4.950 3.465 N Eps8l1 n/a
4 TRCN0000098256 CCTAGTCAAGTCACTCTGCTT pLKO.1 553 CDS 100% 2.640 1.848 N Eps8l1 n/a
5 TRCN0000098255 CAGTGGCAGTAGATGCCATAA pLKO.1 2557 3UTR 100% 1.080 0.756 N Eps8l1 n/a
6 TRCN0000179830 CCTGAAGCAGTTCAGTTCTTT pLKO.1 3398 3UTR 100% 0.563 0.338 N CRTAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.