Transcript: Mouse XM_006540360.2

PREDICTED: Mus musculus carcinoembryonic antigen-related cell adhesion molecule 20 (Ceacam20), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ceacam20 (71601)
Length:
2249
CDS:
137..1876

Additional Resources:

NCBI RefSeq record:
XM_006540360.2
NBCI Gene record:
Ceacam20 (71601)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540360.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094594 GCACTTTAGAATCCAGCCATT pLKO.1 1946 3UTR 100% 4.050 5.670 N Ceacam20 n/a
2 TRCN0000094597 GCTTGTGTTGAATGAGCGCAT pLKO.1 403 CDS 100% 2.160 3.024 N Ceacam20 n/a
3 TRCN0000094595 CCATAGTCTTTACTGCAAGAT pLKO.1 1840 CDS 100% 4.950 3.960 N Ceacam20 n/a
4 TRCN0000094598 CCTCACAGTCAATCAGAGCAT pLKO.1 295 CDS 100% 2.640 2.112 N Ceacam20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540360.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.