Transcript: Mouse XM_006540433.3

PREDICTED: Mus musculus membrane bound O-acyltransferase domain containing 7 (Mboat7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mboat7 (77582)
Length:
2730
CDS:
717..2060

Additional Resources:

NCBI RefSeq record:
XM_006540433.3
NBCI Gene record:
Mboat7 (77582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540433.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247414 TCCGTAACATCGACTGCTATG pLKO_005 1534 CDS 100% 6.000 8.400 N Mboat7 n/a
2 TRCN0000175517 CTACTGTTACGTGGGAATCAT pLKO.1 1106 CDS 100% 5.625 7.875 N Mboat7 n/a
3 TRCN0000217144 CTGGTTACTACCTAAGCTTCA pLKO.1 1717 CDS 100% 4.050 3.240 N Mboat7 n/a
4 TRCN0000247411 CCTGTTGGCTTCCTCTTTAAG pLKO_005 673 5UTR 100% 13.200 9.240 N Mboat7 n/a
5 TRCN0000217121 CTGCTAACATCAGGGTATTAC pLKO.1 2301 3UTR 100% 13.200 9.240 N Mboat7 n/a
6 TRCN0000247413 TCTACTTCTGGGTCCACTTTC pLKO_005 1924 CDS 100% 10.800 7.560 N Mboat7 n/a
7 TRCN0000247410 TGATGGAGACACTCAGCTATA pLKO_005 1084 CDS 100% 10.800 7.560 N Mboat7 n/a
8 TRCN0000247412 ATGCGTGCCTACGACTACATG pLKO_005 1848 CDS 100% 4.950 3.465 N Mboat7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540433.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.