Transcript: Mouse XM_006540566.1

PREDICTED: Mus musculus aggrecan (Acan), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acan (11595)
Length:
7750
CDS:
415..6927

Additional Resources:

NCBI RefSeq record:
XM_006540566.1
NBCI Gene record:
Acan (11595)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071731 GAGGTCATAGTGAAAGGTATT pLKO.1 853 CDS 100% 10.800 15.120 N Acan n/a
2 TRCN0000071728 CGGTCTGAATGACAGGACTAT pLKO.1 6465 CDS 100% 4.950 6.930 N Acan n/a
3 TRCN0000453266 ACAACAGAAGTGCCATATTTC pLKO_005 2593 CDS 100% 13.200 9.240 N Acan n/a
4 TRCN0000071732 CTGGATTTAGTGGTGAGTATT pLKO.1 4151 CDS 100% 13.200 9.240 N Acan n/a
5 TRCN0000438988 GTCATATAAGGAATCCATTAA pLKO_005 7022 3UTR 100% 13.200 9.240 N Acan n/a
6 TRCN0000071729 CGGAAGTGAGTGGAGAATCTA pLKO.1 5828 CDS 100% 5.625 3.938 N Acan n/a
7 TRCN0000071730 CCATCATCAGAAACCTATGAT pLKO.1 2125 CDS 100% 0.563 0.394 N Acan n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.