Transcript: Mouse XM_006540593.4

PREDICTED: Mus musculus CD37 antigen (Cd37), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cd37 (12493)
Length:
1913
CDS:
291..1406

Additional Resources:

NCBI RefSeq record:
XM_006540593.4
NBCI Gene record:
Cd37 (12493)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540593.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068203 CGCTCTCAATATTCCTGTGTA pLKO.1 1585 3UTR 100% 4.950 6.930 N Cd37 n/a
2 TRCN0000381694 ACCAGCTTCGTGTCCTTTGTG pLKO_005 402 CDS 100% 4.950 3.465 N CD37 n/a
3 TRCN0000068206 CTCCTGTTTGCCACACAGATT pLKO.1 567 CDS 100% 4.950 3.465 N Cd37 n/a
4 TRCN0000057551 GCTCCTGTTTGCCACACAGAT pLKO.1 566 CDS 100% 4.950 3.465 N CD37 n/a
5 TRCN0000068205 CCACCGTCTTTGATAAGCTCT pLKO.1 850 CDS 100% 2.640 1.848 N Cd37 n/a
6 TRCN0000068204 CCTCATTGACAAGACCAGCTT pLKO.1 389 CDS 100% 2.640 1.848 N Cd37 n/a
7 TRCN0000057550 CCTCCAGAAGTGGCTGCACAA pLKO.1 980 CDS 100% 1.350 0.945 N CD37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540593.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.