Transcript: Mouse XM_006540638.2

PREDICTED: Mus musculus HECT and RLD domain containing E3 ubiquitin protein ligase 2 (Herc2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Herc2 (15204)
Length:
15292
CDS:
120..14630

Additional Resources:

NCBI RefSeq record:
XM_006540638.2
NBCI Gene record:
Herc2 (15204)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305643 ACCGATAGGACCTAGTGTTTA pLKO_005 14851 3UTR 100% 13.200 18.480 N Herc2 n/a
2 TRCN0000039445 GCCTGCTCATTAGTAAACTTT pLKO.1 3298 CDS 100% 5.625 7.875 N Herc2 n/a
3 TRCN0000323951 GCCTGCTCATTAGTAAACTTT pLKO_005 3298 CDS 100% 5.625 7.875 N Herc2 n/a
4 TRCN0000039447 GCGTTATTAACTTACTGCAAA pLKO.1 6019 CDS 100% 4.950 6.930 N Herc2 n/a
5 TRCN0000305696 GCTGCGCAGAGACCCATAAAT pLKO_005 11716 CDS 100% 15.000 12.000 N Herc2 n/a
6 TRCN0000118376 CCTCTCTATAATGTCTAAGTT pLKO.1 4703 CDS 100% 5.625 3.938 N HERC2P2 n/a
7 TRCN0000039446 CCACAGAATTTGGGCAGTCAA pLKO.1 11473 CDS 100% 4.950 3.465 N Herc2 n/a
8 TRCN0000039444 GCCTCCAGAAACATTGTGAAA pLKO.1 1593 CDS 100% 4.950 3.465 N Herc2 n/a
9 TRCN0000324021 GCCTCCAGAAACATTGTGAAA pLKO_005 1593 CDS 100% 4.950 3.465 N Herc2 n/a
10 TRCN0000039448 GCGCTACTTCATTGCCTTGAA pLKO.1 566 CDS 100% 4.950 3.465 N Herc2 n/a
11 TRCN0000323959 GCGCTACTTCATTGCCTTGAA pLKO_005 566 CDS 100% 4.950 3.465 N Herc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.