Transcript: Mouse XM_006540675.3

PREDICTED: Mus musculus kallikrein 1-related petidase b26 (Klk1b26), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klk1b26 (16618)
Length:
936
CDS:
204..887

Additional Resources:

NCBI RefSeq record:
XM_006540675.3
NBCI Gene record:
Klk1b26 (16618)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540675.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032116 ACCACATCAAATGGCCCTGAA pLKO.1 777 CDS 100% 4.050 2.430 N Klk1b26 n/a
2 TRCN0000031373 GCCTCCTGATGCTTCAAACAA pLKO.1 412 CDS 100% 5.625 2.813 Y Egfbp2 n/a
3 TRCN0000031369 CCCACTGATTTGTGATGGTAT pLKO.1 746 CDS 100% 4.950 2.475 Y Egfbp2 n/a
4 TRCN0000031306 CCTGCTGACATCACAGATGTT pLKO.1 486 CDS 100% 4.950 2.475 Y Klk1b1 n/a
5 TRCN0000031371 GCAGCATTACACCCACAAGAT pLKO.1 574 CDS 100% 4.950 2.475 Y Egfbp2 n/a
6 TRCN0000031372 GCCAAAGTCTACCTACAGAAA pLKO.1 654 CDS 100% 4.950 2.475 Y Egfbp2 n/a
7 TRCN0000031370 CCCAATGAGAACTGTGCCAAA pLKO.1 639 CDS 100% 4.050 2.025 Y Egfbp2 n/a
8 TRCN0000032118 CTTCAACATGAGCCTCCTGAT pLKO.1 401 CDS 100% 4.050 2.025 Y Klk1b26 n/a
9 TRCN0000032117 GTGATGGTATTCTCCAAGGAA pLKO.1 757 CDS 100% 3.000 1.500 Y Klk1b26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540675.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.