Transcript: Mouse XM_006540793.3

PREDICTED: Mus musculus testis-specific serine kinase substrate (Tsks), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tsks (22116)
Length:
1943
CDS:
172..1914

Additional Resources:

NCBI RefSeq record:
XM_006540793.3
NBCI Gene record:
Tsks (22116)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362743 GCAGATGAGTTGTGCACTATG pLKO_005 1228 CDS 100% 10.800 15.120 N Tsks n/a
2 TRCN0000079088 GCCACTTTGGACTATATGCAT pLKO.1 1768 CDS 100% 3.000 4.200 N Tsks n/a
3 TRCN0000079092 AGCAGATGAGTTGTGCACTAT pLKO.1 1227 CDS 100% 4.950 3.960 N Tsks n/a
4 TRCN0000362679 GGTGGCCACTTTGGACTATAT pLKO_005 1764 CDS 100% 13.200 9.240 N Tsks n/a
5 TRCN0000362742 GCTCTGTGCTGAGTGAGAATC pLKO_005 578 CDS 100% 10.800 7.560 N Tsks n/a
6 TRCN0000362676 TCAGTGGAAGACGCTGAAATC pLKO_005 706 CDS 100% 10.800 7.560 N Tsks n/a
7 TRCN0000037652 CAGAGGCTACACAAGAAGATT pLKO.1 1534 CDS 100% 5.625 3.375 N TSKS n/a
8 TRCN0000079090 GCTGGAGGAGAAGCTAAGATA pLKO.1 759 CDS 100% 5.625 3.375 N Tsks n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.