Transcript: Mouse XM_006540823.3

PREDICTED: Mus musculus anoctamin 5 (Ano5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ano5 (233246)
Length:
7773
CDS:
268..3864

Additional Resources:

NCBI RefSeq record:
XM_006540823.3
NBCI Gene record:
Ano5 (233246)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540823.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250579 ATCGTTTCTGTTGCAACTAAT pLKO_005 3337 CDS 100% 13.200 18.480 N Ano5 n/a
2 TRCN0000250576 CCTTGAGTGGATACGTCAATA pLKO_005 3437 CDS 100% 13.200 18.480 N Ano5 n/a
3 TRCN0000250577 TATCCTACTCCTGAGTATTTC pLKO_005 1666 CDS 100% 13.200 18.480 N Ano5 n/a
4 TRCN0000250580 GGGAATCAAGATGCCTATTAA pLKO_005 1566 CDS 100% 15.000 10.500 N Ano5 n/a
5 TRCN0000193666 CATGAACAACATCATGGGAAT pLKO.1 3216 CDS 100% 0.405 0.284 N Ano5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540823.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.