Transcript: Mouse XM_006540857.3

PREDICTED: Mus musculus protein regulator of cytokinesis 1 (Prc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prc1 (233406)
Length:
2984
CDS:
125..1816

Additional Resources:

NCBI RefSeq record:
XM_006540857.3
NBCI Gene record:
Prc1 (233406)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540857.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219538 CTAACTCACCTCCGGGAAATA pLKO.1 179 CDS 100% 13.200 18.480 N Prc1 n/a
2 TRCN0000340487 CTAACTCACCTCCGGGAAATA pLKO_005 179 CDS 100% 13.200 18.480 N Prc1 n/a
3 TRCN0000217220 CTACGTCTCGAATCCTCAATT pLKO.1 1870 3UTR 100% 13.200 18.480 N Prc1 n/a
4 TRCN0000219541 TGATTCAAGAGAGACCTTAAA pLKO.1 2115 3UTR 100% 13.200 10.560 N Prc1 n/a
5 TRCN0000352509 TGATTCAAGAGAGACCTTAAA pLKO_005 2115 3UTR 100% 13.200 10.560 N Prc1 n/a
6 TRCN0000219539 GAGCCTGTGGAGGCAATTATG pLKO.1 896 CDS 100% 13.200 9.240 N Prc1 n/a
7 TRCN0000219540 ATGCCGAGATTGTACGGTTAA pLKO.1 1128 CDS 100% 10.800 7.560 N Prc1 n/a
8 TRCN0000340562 ATGCCGAGATTGTACGGTTAA pLKO_005 1128 CDS 100% 10.800 7.560 N Prc1 n/a
9 TRCN0000190626 GCGCACTCAAGTAGAATTGAT pLKO.1 433 CDS 100% 5.625 3.938 N Prc1 n/a
10 TRCN0000215814 CTTTGCACATCTACAAGTTAT pLKO.1 2766 3UTR 100% 13.200 7.920 N Prc1 n/a
11 TRCN0000340488 CTTTGCACATCTACAAGTTAT pLKO_005 2766 3UTR 100% 13.200 7.920 N Prc1 n/a
12 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 2230 3UTR 100% 2.640 1.320 Y Adsl n/a
13 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 2230 3UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540857.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.