Transcript: Mouse XM_006540921.3

PREDICTED: Mus musculus tubulin tyrosine ligase-like family, member 13 (Ttll13), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttll13 (269954)
Length:
3050
CDS:
273..2540

Additional Resources:

NCBI RefSeq record:
XM_006540921.3
NBCI Gene record:
Ttll13 (269954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098647 CGGATCTTCATGTACGAGGAA pLKO.1 1110 CDS 100% 2.640 3.696 N Ttll13 n/a
2 TRCN0000418747 TAATTGAAAGACTGCCAACAA pLKO_005 2615 3UTR 100% 4.950 3.960 N Ttll13 n/a
3 TRCN0000098645 CCAAGCCTTAGGCTGAGTTTA pLKO.1 2789 3UTR 100% 13.200 9.240 N Ttll13 n/a
4 TRCN0000098649 CAGCAAATGGTCTTCAATCTT pLKO.1 2591 3UTR 100% 5.625 3.938 N Ttll13 n/a
5 TRCN0000181196 CCACAACTACCGAACCTGTTT pLKO.1 1388 CDS 100% 4.950 3.465 N TTLL13P n/a
6 TRCN0000418455 GGTCACTGGGCAACAAGGAAT pLKO_005 2855 3UTR 100% 4.950 3.465 N Ttll13 n/a
7 TRCN0000098648 GCCCAAGAACTTCAACTGGAT pLKO.1 2445 CDS 100% 2.640 1.848 N Ttll13 n/a
8 TRCN0000098646 GCACCTTTCTTCAAGCACAAT pLKO.1 1800 CDS 100% 4.950 2.970 N Ttll13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.