Transcript: Mouse XM_006540943.3

PREDICTED: Mus musculus secretion regulating guanine nucleotide exchange factor (Sergef), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sergef (27414)
Length:
1790
CDS:
372..1769

Additional Resources:

NCBI RefSeq record:
XM_006540943.3
NBCI Gene record:
Sergef (27414)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110212 GAGCACAACTTGGCAGTAATT pLKO.1 1401 CDS 100% 13.200 18.480 N Sergef n/a
2 TRCN0000328103 AGCACAACTTGGCAGTAATTA pLKO_005 1402 CDS 100% 15.000 10.500 N Sergef n/a
3 TRCN0000328102 CAGAAACTGGCAAGGTGTTTA pLKO_005 1216 CDS 100% 13.200 9.240 N Sergef n/a
4 TRCN0000110214 CCAGAGAATAGAAGCACATTA pLKO.1 1136 CDS 100% 13.200 9.240 N Sergef n/a
5 TRCN0000328104 TCTGACCACTCGGCCTCATTA pLKO_005 1035 CDS 100% 13.200 9.240 N Sergef n/a
6 TRCN0000328105 GAATAGAAGCACATTACTTTC pLKO_005 1141 CDS 100% 10.800 7.560 N Sergef n/a
7 TRCN0000328172 GCAACTTGGCCTTGGCCATAA pLKO_005 452 CDS 100% 10.800 7.560 N Sergef n/a
8 TRCN0000110213 GCAAACAGCTATGGGCAACTT pLKO.1 438 CDS 100% 4.950 3.465 N Sergef n/a
9 TRCN0000110211 GCACATTACTTTCAGGATGAA pLKO.1 1149 CDS 100% 4.950 3.465 N Sergef n/a
10 TRCN0000110210 CCTGAATAAAGATGGGCAGTT pLKO.1 596 CDS 100% 4.050 2.835 N Sergef n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.