Transcript: Mouse XM_006540952.2

PREDICTED: Mus musculus kallikrein related-peptidase 15 (Klk15), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klk15 (317652)
Length:
1107
CDS:
81..845

Additional Resources:

NCBI RefSeq record:
XM_006540952.2
NBCI Gene record:
Klk15 (317652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032358 GACTCCCTGATACGTTGCATT pLKO.1 559 CDS 100% 4.950 6.930 N Klk15 n/a
2 TRCN0000416530 AGCACAATCTCCGCAAGTTCG pLKO_005 295 CDS 100% 4.050 5.670 N Klk15 n/a
3 TRCN0000032354 CCGGTTTAATTGTGGCGCTTT pLKO.1 203 CDS 100% 4.050 5.670 N Klk15 n/a
4 TRCN0000436879 CAAGTAGCCCTCTTCGAACGT pLKO_005 180 CDS 100% 2.640 3.696 N Klk15 n/a
5 TRCN0000032356 GCATTATCTCTGAAGCATCTT pLKO.1 592 CDS 100% 4.950 3.465 N Klk15 n/a
6 TRCN0000032355 CCGCCATGACATTATGCTGTT pLKO.1 383 CDS 100% 4.050 2.835 N Klk15 n/a
7 TRCN0000032357 CCACTGCCAAACCCGCTTCAT pLKO.1 257 CDS 100% 1.650 1.155 N Klk15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.