Transcript: Mouse XM_006540972.3

PREDICTED: Mus musculus family with sequence similarity 169, member B (Fam169b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam169b (434197)
Length:
3202
CDS:
407..1435

Additional Resources:

NCBI RefSeq record:
XM_006540972.3
NBCI Gene record:
Fam169b (434197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540972.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192159 CCATCGAAGACATCCTAAGAA pLKO.1 702 CDS 100% 5.625 7.875 N Fam169b n/a
2 TRCN0000190487 GTTGTCCGATATCTCCTGCAA pLKO.1 1086 CDS 100% 2.640 3.696 N Fam169b n/a
3 TRCN0000191297 CACAGTTTAATCATGGAGAAA pLKO.1 1326 CDS 100% 4.950 3.960 N Fam169b n/a
4 TRCN0000190694 GCGTGTTAACATCTGGCTCAA pLKO.1 1198 CDS 100% 4.050 3.240 N Fam169b n/a
5 TRCN0000191601 GCACACATACTTCTCTCATTT pLKO.1 2172 3UTR 100% 13.200 9.240 N Fam169b n/a
6 TRCN0000191899 GAAAGGATTGTTCTCTTTGTT pLKO.1 770 CDS 100% 5.625 3.938 N Fam169b n/a
7 TRCN0000192571 GCAGGACTTTAGAACGTCATT pLKO.1 1648 3UTR 100% 4.950 3.465 N Fam169b n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2280 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540972.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.