Transcript: Mouse XM_006541304.3

PREDICTED: Mus musculus neuron navigator 2 (Nav2), transcript variant X18, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nav2 (78286)
Length:
9214
CDS:
866..7717

Additional Resources:

NCBI RefSeq record:
XM_006541304.3
NBCI Gene record:
Nav2 (78286)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541304.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374894 AGAGACCCTACAACGAAATAC pLKO_005 3673 CDS 100% 13.200 18.480 N Nav2 n/a
2 TRCN0000305038 CCAATCATTACCTCGCTAAAT pLKO_005 1140 CDS 100% 13.200 18.480 N Nav2 n/a
3 TRCN0000305005 TGACATCACTAGCGGGTATAT pLKO_005 3583 CDS 100% 13.200 18.480 N Nav2 n/a
4 TRCN0000374833 ACGGTCATGCAGTTACGAAAT pLKO_005 5957 CDS 100% 10.800 15.120 N Nav2 n/a
5 TRCN0000108669 CAGGGCGCTTACCAATAAGAA pLKO.1 2359 CDS 100% 5.625 7.875 N Nav2 n/a
6 TRCN0000108668 GAGCTTTAACAACTACGACAA pLKO.1 1801 CDS 100% 4.050 5.670 N Nav2 n/a
7 TRCN0000308678 GAGCTTTAACAACTACGACAA pLKO_005 1801 CDS 100% 4.050 5.670 N Nav2 n/a
8 TRCN0000149447 GCACCTTGATAGGAACACTTT pLKO.1 4861 CDS 100% 4.950 3.960 N NAV2 n/a
9 TRCN0000336713 GCACCTTGATAGGAACACTTT pLKO_005 4861 CDS 100% 4.950 3.960 N NAV2 n/a
10 TRCN0000305040 TCGGCGACTTCGGACAGTAAA pLKO_005 3115 CDS 100% 13.200 9.240 N Nav2 n/a
11 TRCN0000108666 CCACCAAGTAACCATGAGAAA pLKO.1 1856 CDS 100% 4.950 3.465 N Nav2 n/a
12 TRCN0000108667 CCCTAACAATCAGAAATCCAT pLKO.1 2122 CDS 100% 3.000 2.100 N Nav2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541304.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.