Transcript: Mouse XM_006541437.3

PREDICTED: Mus musculus muscleblind-like 3 (Drosophila) (Mbnl3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mbnl3 (171170)
Length:
8668
CDS:
94..1158

Additional Resources:

NCBI RefSeq record:
XM_006541437.3
NBCI Gene record:
Mbnl3 (171170)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159144 GTAGAGAATTTCAGAGAGGAA pLKO.1 152 CDS 100% 2.640 2.112 N MBNL3 n/a
2 TRCN0000348500 CTTGTACCAACACGACAATAA pLKO_005 1237 3UTR 100% 13.200 9.240 N Mbnl3 n/a
3 TRCN0000102510 GCAGTGAATTAGCAAGCATTT pLKO.1 2619 3UTR 100% 10.800 7.560 N Mbnl3 n/a
4 TRCN0000102514 CCTACGGATGTTTCCATGATT pLKO.1 691 CDS 100% 5.625 3.938 N Mbnl3 n/a
5 TRCN0000162715 CGGGAGAAATGCAAGTACTTT pLKO.1 769 CDS 100% 5.625 3.938 N MBNL3 n/a
6 TRCN0000102512 GCTAGAAGTTAATGGGAGAAA pLKO.1 330 CDS 100% 4.950 3.465 N Mbnl3 n/a
7 TRCN0000335179 GCTAGAAGTTAATGGGAGAAA pLKO_005 330 CDS 100% 4.950 3.465 N Mbnl3 n/a
8 TRCN0000102513 GCTCTGGCTAACATGCAGATT pLKO.1 970 CDS 100% 4.950 3.465 N Mbnl3 n/a
9 TRCN0000335181 GCTCTGGCTAACATGCAGATT pLKO_005 970 CDS 100% 4.950 3.465 N Mbnl3 n/a
10 TRCN0000102511 CGTGAATTTCAGCGTGGAAAT pLKO.1 634 CDS 100% 1.080 0.756 N Mbnl3 n/a
11 TRCN0000335104 CGTGAATTTCAGCGTGGAAAT pLKO_005 634 CDS 100% 1.080 0.756 N Mbnl3 n/a
12 TRCN0000164411 CCAAGAGTTTGCCATGTGGAA pLKO.1 214 CDS 100% 2.640 1.584 N MBNL3 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6366 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.