Transcript: Mouse XM_006541497.3

PREDICTED: Mus musculus BCL6 co-repressor-like 1 (Bcorl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcorl1 (320376)
Length:
7584
CDS:
370..5715

Additional Resources:

NCBI RefSeq record:
XM_006541497.3
NBCI Gene record:
Bcorl1 (320376)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085730 GCACAGTGAAATCCCGTTATA pLKO.1 2690 CDS 100% 13.200 18.480 N Bcorl1 n/a
2 TRCN0000085732 GTGGTCAATGACAACCTAGAA pLKO.1 5074 CDS 100% 4.950 6.930 N Bcorl1 n/a
3 TRCN0000085729 CGGAGACTTATAGTGAATAAA pLKO.1 4822 CDS 100% 15.000 10.500 N Bcorl1 n/a
4 TRCN0000085731 GCCACTCTAAGGAACTCATTT pLKO.1 3401 CDS 100% 13.200 9.240 N Bcorl1 n/a
5 TRCN0000085728 GCCTTATCAATGCCAGCATTA pLKO.1 5838 3UTR 100% 10.800 7.560 N Bcorl1 n/a
6 TRCN0000033474 CGCCTTATCAATGCCAGCATT pLKO.1 5837 3UTR 100% 4.950 3.465 N BCORL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.