Transcript: Human XM_006710428.3

PREDICTED: Homo sapiens sperm associated antigen 17 (SPAG17), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPAG17 (200162)
Length:
5000
CDS:
321..4811

Additional Resources:

NCBI RefSeq record:
XM_006710428.3
NBCI Gene record:
SPAG17 (200162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710428.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253642 GGATATTAAGAACCGCATAAT pLKO_005 3842 CDS 100% 13.200 18.480 N SPAG17 n/a
2 TRCN0000253639 TTTAATAAAGACGTGCGAATA pLKO_005 4965 3UTR 100% 10.800 15.120 N SPAG17 n/a
3 TRCN0000167306 CGATAAGTTACTATGGATCAA pLKO.1 1537 CDS 100% 4.950 6.930 N SPAG17 n/a
4 TRCN0000253638 TGGTAGCATATCAACTATATT pLKO_005 2927 CDS 100% 15.000 9.000 N SPAG17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710428.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.