Transcript: Human XM_006710489.3

PREDICTED: Homo sapiens adhesion G protein-coupled receptor L2 (ADGRL2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRL2 (23266)
Length:
5624
CDS:
124..4518

Additional Resources:

NCBI RefSeq record:
XM_006710489.3
NBCI Gene record:
ADGRL2 (23266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710489.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357600 GCGATTGCATGCCCAATATTT pLKO_005 2857 CDS 100% 15.000 21.000 N ADGRL2 n/a
2 TRCN0000011723 CCCGATTAAACCGAGGAGAAT pLKO.1 1175 CDS 100% 4.950 6.930 N ADGRL2 n/a
3 TRCN0000011724 CCACAGGGAAATTGCATATAA pLKO.1 2634 CDS 100% 15.000 10.500 N ADGRL2 n/a
4 TRCN0000357529 GGCAATAGTGATGGTTATATA pLKO_005 4420 CDS 100% 15.000 10.500 N ADGRL2 n/a
5 TRCN0000357599 GGCATATCTCTTCACTATATT pLKO_005 3333 CDS 100% 15.000 10.500 N ADGRL2 n/a
6 TRCN0000011726 GCCAATGAACTGGCTAAACAT pLKO.1 1765 CDS 100% 5.625 3.938 N ADGRL2 n/a
7 TRCN0000011725 CCTGGAACATACAAATACCTT pLKO.1 472 CDS 100% 3.000 2.100 N ADGRL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710489.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.