Transcript: Human XM_006711803.3

PREDICTED: Homo sapiens ryanodine receptor 2 (RYR2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RYR2 (6262)
Length:
16285
CDS:
315..15269

Additional Resources:

NCBI RefSeq record:
XM_006711803.3
NBCI Gene record:
RYR2 (6262)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711803.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426031 ATGAACCATTTGCCGTTAATA pLKO_005 4018 CDS 100% 15.000 21.000 N RYR2 n/a
2 TRCN0000053313 CGAGATATAATCCGCAGCAAT pLKO.1 10857 CDS 100% 4.950 6.930 N RYR2 n/a
3 TRCN0000423253 TCCGTGAGAATGGGATCTATA pLKO_005 1455 CDS 100% 13.200 10.560 N RYR2 n/a
4 TRCN0000053314 GCCATAATACAAGGTCTAATT pLKO.1 14943 CDS 100% 13.200 9.240 N RYR2 n/a
5 TRCN0000053317 GCTCTCAGTTTGCCAACTAAT pLKO.1 9921 CDS 100% 13.200 9.240 N RYR2 n/a
6 TRCN0000053316 CCCAACAACTACTGGGACAAA pLKO.1 14286 CDS 100% 4.950 3.465 N RYR2 n/a
7 TRCN0000053315 GCCTCTTCTTTCCAGTCGTTA pLKO.1 2671 CDS 100% 4.950 3.465 N RYR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711803.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.