Transcript: Human XM_006711870.4

PREDICTED: Homo sapiens lipin 1 (LPIN1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LPIN1 (23175)
Length:
5770
CDS:
365..3163

Additional Resources:

NCBI RefSeq record:
XM_006711870.4
NBCI Gene record:
LPIN1 (23175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711870.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414897 ATCGCTAAGCTGTACCATAAA pLKO_005 2603 CDS 100% 13.200 18.480 N LPIN1 n/a
2 TRCN0000419880 TCCCGACCTTCAACACCTAAA pLKO_005 1223 CDS 100% 10.800 15.120 N LPIN1 n/a
3 TRCN0000431256 TTCATTCTGCCTCAGCGTAAA pLKO_005 3144 CDS 100% 10.800 15.120 N LPIN1 n/a
4 TRCN0000155793 CCACCAGGGTAAAGCATGAAT pLKO.1 2262 CDS 100% 5.625 3.938 N LPIN1 n/a
5 TRCN0000150763 GCAGAACTCTTCCTAATGATA pLKO.1 975 CDS 100% 5.625 3.938 N LPIN1 n/a
6 TRCN0000098298 CCAGTGTTTGACAGACATCAA pLKO.1 2821 CDS 100% 4.950 3.465 N Lpin1 n/a
7 TRCN0000324696 CCAGTGTTTGACAGACATCAA pLKO_005 2821 CDS 100% 4.950 3.465 N Lpin1 n/a
8 TRCN0000154092 CCTCAGACAGAAATGCAGTTT pLKO.1 1496 CDS 100% 4.950 3.465 N LPIN1 n/a
9 TRCN0000156014 CCTGTTCGGATACCTTCAGTA pLKO.1 3075 CDS 100% 4.950 3.465 N LPIN1 n/a
10 TRCN0000153806 CGAGAGAAAGTGGTTGACATA pLKO.1 563 CDS 100% 4.950 3.465 N LPIN1 n/a
11 TRCN0000156186 CCTTCCAGAAACCTTTGCCAA pLKO.1 2073 CDS 100% 2.640 1.848 N LPIN1 n/a
12 TRCN0000154038 CCAGGGTAAAGCATGAATCAT pLKO.1 2265 CDS 100% 5.625 3.375 N LPIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711870.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.