Transcript: Human XM_006712539.3

PREDICTED: Homo sapiens myosin VIIB (MYO7B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO7B (4648)
Length:
6904
CDS:
167..6595

Additional Resources:

NCBI RefSeq record:
XM_006712539.3
NBCI Gene record:
MYO7B (4648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247715 CTGTCAGCACCGAGCTTATTT pLKO_005 4143 CDS 100% 15.000 21.000 N MYO7B n/a
2 TRCN0000247713 AGGTGTACTTCATGCGGAAAT pLKO_005 5904 CDS 100% 10.800 15.120 N MYO7B n/a
3 TRCN0000247712 ATATCCACTACACCGACAATC pLKO_005 1623 CDS 100% 10.800 15.120 N MYO7B n/a
4 TRCN0000247714 ACCAGCAGCACAAGATCTATA pLKO_005 432 CDS 100% 13.200 9.240 N MYO7B n/a
5 TRCN0000247711 ACATCGCCTGCCAGATCTTTG pLKO_005 5238 CDS 100% 10.800 7.560 N MYO7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.