Transcript: Human XM_006712817.3

PREDICTED: Homo sapiens ATP binding cassette subfamily B member 11 (ABCB11), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCB11 (8647)
Length:
5029
CDS:
197..4204

Additional Resources:

NCBI RefSeq record:
XM_006712817.3
NBCI Gene record:
ABCB11 (8647)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712817.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413748 ATTAGCTGTTGTAGATCATAA pLKO_005 2371 CDS 100% 13.200 10.560 N ABCB11 n/a
2 TRCN0000425396 GGGAGCTACCAGGATAGTTTA pLKO_005 2291 CDS 100% 13.200 10.560 N ABCB11 n/a
3 TRCN0000420460 ACAGATATGGAGGTTACTTAA pLKO_005 3237 CDS 100% 13.200 9.240 N ABCB11 n/a
4 TRCN0000419038 AGCATGGGCACACAATCATTT pLKO_005 2052 CDS 100% 13.200 9.240 N ABCB11 n/a
5 TRCN0000059362 CCCAGAGAAATATGAAACTAA pLKO.1 3850 CDS 100% 5.625 3.938 N ABCB11 n/a
6 TRCN0000059360 CCCATGAAGAATTACTGGAAA pLKO.1 2154 CDS 100% 4.950 3.465 N ABCB11 n/a
7 TRCN0000059358 GCCATGACATTCGCTCTCTTA pLKO.1 1686 CDS 100% 4.950 3.465 N ABCB11 n/a
8 TRCN0000059361 GCTCAAACATTGGAATTGTTT pLKO.1 3696 CDS 100% 0.563 0.394 N ABCB11 n/a
9 TRCN0000059359 GCCAGTTACTATGCTGGAATT pLKO.1 662 CDS 100% 0.000 0.000 N ABCB11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712817.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.