Transcript: Human XM_006712954.3

PREDICTED: Homo sapiens solute carrier family 38 member 3 (SLC38A3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC38A3 (10991)
Length:
3012
CDS:
189..1703

Additional Resources:

NCBI RefSeq record:
XM_006712954.3
NBCI Gene record:
SLC38A3 (10991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712954.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007641 GAACGGGAACTACCTGGTAAT pLKO.1 749 CDS 100% 10.800 15.120 N SLC38A3 n/a
2 TRCN0000007639 CGCGATTAACACTGTGGCATT pLKO.1 1802 3UTR 100% 4.050 5.670 N SLC38A3 n/a
3 TRCN0000007642 GCCACTTGTCATACAGACCTT pLKO.1 692 CDS 100% 2.640 3.696 N SLC38A3 n/a
4 TRCN0000007643 GCTCACTTGTATCAACCTGCT pLKO.1 1430 CDS 100% 2.160 3.024 N SLC38A3 n/a
5 TRCN0000436551 GCATGGTGTTCTTCCTAATTG pLKO_005 856 CDS 100% 13.200 10.560 N SLC38A3 n/a
6 TRCN0000431233 ACACAGCCTGTAGGAACATAC pLKO_005 2032 3UTR 100% 10.800 7.560 N SLC38A3 n/a
7 TRCN0000419198 GCCATCTTCTACTTCCGAATC pLKO_005 1533 CDS 100% 6.000 4.200 N SLC38A3 n/a
8 TRCN0000007640 CGCTGTCATGTACATCATGTA pLKO.1 1166 CDS 100% 4.950 3.465 N SLC38A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712954.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.