Transcript: Human XM_006712985.1

PREDICTED: Homo sapiens catenin beta 1 (CTNNB1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTNNB1 (1499)
Length:
3104
CDS:
243..2405

Additional Resources:

NCBI RefSeq record:
XM_006712985.1
NBCI Gene record:
CTNNB1 (1499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003844 CGCATGGAAGAAATAGTTGAA pLKO.1 1935 CDS 100% 4.950 3.960 N CTNNB1 n/a
2 TRCN0000314990 ATCTGTCTGCTCTAGTAATAA pLKO_005 1283 CDS 100% 15.000 10.500 N CTNNB1 n/a
3 TRCN0000314921 TCTAACCTCACTTGCAATAAT pLKO_005 1515 CDS 100% 15.000 10.500 N CTNNB1 n/a
4 TRCN0000003843 AGGTGCTATCTGTCTGCTCTA pLKO.1 1276 CDS 100% 4.050 2.835 N CTNNB1 n/a
5 TRCN0000010824 CCATTGTTTGTGCAGCTGCTT pLKO.1 2031 CDS 100% 2.640 1.848 N CTNNB1 n/a
6 TRCN0000314991 TTGTTATCAGAGGACTAAATA pLKO_005 2005 CDS 100% 15.000 9.000 N CTNNB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.