Transcript: Human XM_006713173.2

PREDICTED: Homo sapiens natural killer cell triggering receptor (NKTR), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NKTR (4820)
Length:
7117
CDS:
495..4556

Additional Resources:

NCBI RefSeq record:
XM_006713173.2
NBCI Gene record:
NKTR (4820)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713173.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271575 TAGATCTCATTCACGAAATAA pLKO_005 2336 CDS 100% 15.000 21.000 N NKTR n/a
2 TRCN0000271572 TCCAGATCATGGTCCTATAAT pLKO_005 1380 CDS 100% 15.000 21.000 N NKTR n/a
3 TRCN0000271576 ATATGCAGATGTGCGAGTTAT pLKO_005 656 CDS 100% 13.200 10.560 N NKTR n/a
4 TRCN0000271574 TAGTCTTTGGACTGGTTATTT pLKO_005 577 CDS 100% 15.000 10.500 N NKTR n/a
5 TRCN0000281806 TCAATCAGCCTTAACTATAAA pLKO_005 5188 3UTR 100% 15.000 10.500 N NKTR n/a
6 TRCN0000154497 GCAGAACCTGAACCGAAGATT pLKO.1 1080 CDS 100% 5.625 3.938 N NKTR n/a
7 TRCN0000151642 CCACATCATCTTATCGATCAA pLKO.1 4195 CDS 100% 4.950 3.465 N NKTR n/a
8 TRCN0000179855 CCGATTCTGAATCAGAGGTTA pLKO.1 2911 CDS 100% 4.950 3.465 N NKTR n/a
9 TRCN0000151128 GCCAAGGAATAAACATGCAAT pLKO.1 905 CDS 100% 4.950 2.970 N NKTR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713173.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.