Transcript: Human XM_006713307.2

PREDICTED: Homo sapiens solute carrier family 6 member 6 (SLC6A6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC6A6 (6533)
Length:
6334
CDS:
43..1992

Additional Resources:

NCBI RefSeq record:
XM_006713307.2
NBCI Gene record:
SLC6A6 (6533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713307.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038412 GCTACAACAAGTACAAGTATA pLKO.1 1070 CDS 100% 13.200 18.480 N SLC6A6 n/a
2 TRCN0000307272 GCTACAACAAGTACAAGTATA pLKO_005 1070 CDS 100% 13.200 18.480 N SLC6A6 n/a
3 TRCN0000038413 CGTCTACTTCACAGCCACTTT pLKO.1 864 CDS 100% 4.950 6.930 N SLC6A6 n/a
4 TRCN0000296782 CGGCTATGCCTCCGTTGTAAT pLKO_005 498 CDS 100% 13.200 10.560 N SLC6A6 n/a
5 TRCN0000296781 TCCTGCTGTTTACTAACATTA pLKO_005 2023 3UTR 100% 13.200 9.240 N SLC6A6 n/a
6 TRCN0000038409 CCTGGATATATGGAGGTGATA pLKO.1 1568 CDS 100% 4.950 3.465 N SLC6A6 n/a
7 TRCN0000038410 GCTAGTGTGTTTCTTCTGCAT pLKO.1 813 CDS 100% 2.640 1.848 N SLC6A6 n/a
8 TRCN0000038411 CCACATCATTGTGGAGACCAT pLKO.1 1965 CDS 100% 0.264 0.185 N SLC6A6 n/a
9 TRCN0000296783 TGCGTTTCTCATACCGTATTT pLKO_005 360 CDS 100% 13.200 7.920 N SLC6A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713307.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13956 pDONR223 100% 30.7% .4% None 1_87del;95delC;688_1947del n/a
2 ccsbBroad304_13956 pLX_304 0% 30.7% .4% V5 (not translated due to prior stop codon) 1_87del;95delC;688_1947del n/a
Download CSV