Transcript: Human XM_006713588.2

PREDICTED: Homo sapiens golgin B1 (GOLGB1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOLGB1 (2804)
Length:
11200
CDS:
127..9921

Additional Resources:

NCBI RefSeq record:
XM_006713588.2
NBCI Gene record:
GOLGB1 (2804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147838 GCAGGACAAATAAGTAAGGAA pLKO.1 3031 CDS 100% 3.000 2.400 N GOLGB1 n/a
2 TRCN0000146702 CCTCACAACTAGAAGATTCTT pLKO.1 8588 CDS 100% 5.625 3.938 N GOLGB1 n/a
3 TRCN0000147752 GCAGACAATCTCAAGTTGAAA pLKO.1 6412 CDS 100% 5.625 3.938 N GOLGB1 n/a
4 TRCN0000147531 GCAGGGATAATGAGAAATGAA pLKO.1 8197 CDS 100% 5.625 3.938 N GOLGB1 n/a
5 TRCN0000148716 CCGTAGCACTTGTAAAGGAAA pLKO.1 3536 CDS 100% 4.950 3.465 N GOLGB1 n/a
6 TRCN0000147839 GAAGGTACTTTAGGACTCTAT pLKO.1 7996 CDS 100% 4.950 3.465 N GOLGB1 n/a
7 TRCN0000147837 GCACTGAACATCAAAGTAGAA pLKO.1 2048 CDS 100% 4.950 3.465 N GOLGB1 n/a
8 TRCN0000147571 GCTTCTGCTTAATCTGAGAAT pLKO.1 10138 3UTR 100% 4.950 3.465 N GOLGB1 n/a
9 TRCN0000148998 GTCTTCCCATTTACAGGTCTT pLKO.1 10007 3UTR 100% 4.050 2.430 N GOLGB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.