Transcript: Human XM_006713884.1

PREDICTED: Homo sapiens leucine zipper and EF-hand containing transmembrane protein 1 (LETM1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LETM1 (3954)
Length:
5167
CDS:
6..2222

Additional Resources:

NCBI RefSeq record:
XM_006713884.1
NBCI Gene record:
LETM1 (3954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056545 CAACGCCATGAAGCAAGTCAA pLKO.1 1964 CDS 100% 4.950 6.930 N LETM1 n/a
2 TRCN0000056546 GCTATGGATCGACACCAAGAT pLKO.1 515 CDS 100% 4.950 6.930 N LETM1 n/a
3 TRCN0000306841 GCTATGGATCGACACCAAGAT pLKO_005 515 CDS 100% 4.950 6.930 N LETM1 n/a
4 TRCN0000056544 CAATGAGGAAATCATGCGTTT pLKO.1 908 CDS 100% 4.050 5.670 N LETM1 n/a
5 TRCN0000307068 CAATGAGGAAATCATGCGTTT pLKO_005 908 CDS 100% 4.050 5.670 N LETM1 n/a
6 TRCN0000056547 GCAGCAAATGATCGGGCAGAT pLKO.1 1838 CDS 100% 4.050 2.835 N LETM1 n/a
7 TRCN0000289561 GCAGCAAATGATCGGGCAGAT pLKO_005 1838 CDS 100% 4.050 2.835 N LETM1 n/a
8 TRCN0000056543 CCAGAGATTGTGGCAAAGGAA pLKO.1 1326 CDS 100% 3.000 2.100 N LETM1 n/a
9 TRCN0000306842 CCAGAGATTGTGGCAAAGGAA pLKO_005 1326 CDS 100% 3.000 2.100 N LETM1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4795 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 4448 3UTR 100% 0.495 0.248 Y C11orf44 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4687 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.