Transcript: Human XM_006713932.3

PREDICTED: Homo sapiens family with sequence similarity 193 member A (FAM193A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM193A (8603)
Length:
5561
CDS:
237..4856

Additional Resources:

NCBI RefSeq record:
XM_006713932.3
NBCI Gene record:
FAM193A (8603)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713932.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263596 GTCTATCAACTGGTCCAATTT pLKO_005 4802 CDS 100% 13.200 18.480 N FAM193A n/a
2 TRCN0000282706 GTGTACACGTTGCGCTGTTTG pLKO_005 5322 3UTR 100% 10.800 15.120 N FAM193A n/a
3 TRCN0000168139 CCATATTTATCCGAGCTGTTT pLKO.1 2708 CDS 100% 4.950 6.930 N FAM193A n/a
4 TRCN0000263594 CAGCCAAATTTGCTGATATTT pLKO_005 2086 CDS 100% 15.000 10.500 N FAM193A n/a
5 TRCN0000252761 CATCTCTTCAAGACCATATTT pLKO_005 2695 CDS 100% 15.000 10.500 N Fam193a n/a
6 TRCN0000263595 CATCTCTTCAAGACCATATTT pLKO_005 2695 CDS 100% 15.000 10.500 N FAM193A n/a
7 TRCN0000282705 ACATCATGCAGCACCATAAAG pLKO_005 4285 CDS 100% 13.200 9.240 N FAM193A n/a
8 TRCN0000172450 CCTTCAGTAGGTGACGTGTTT pLKO.1 3102 CDS 100% 4.950 3.465 N FAM193A n/a
9 TRCN0000172572 GCCACTTCTTCAGAGCAACTT pLKO.1 1355 CDS 100% 4.950 3.465 N FAM193A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713932.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.