Transcript: Human XM_006713977.4

PREDICTED: Homo sapiens LIM domain binding 2 (LDB2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LDB2 (9079)
Length:
2363
CDS:
303..1532

Additional Resources:

NCBI RefSeq record:
XM_006713977.4
NBCI Gene record:
LDB2 (9079)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713977.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424328 CATCAAACGAAGGCCATATTG pLKO_005 1857 3UTR 100% 13.200 18.480 N LDB2 n/a
2 TRCN0000021805 CGAAAGGCTAATCACTAGATT pLKO.1 1358 CDS 100% 5.625 7.875 N LDB2 n/a
3 TRCN0000021804 CGCCACATTAACCCTTTCATT pLKO.1 602 CDS 100% 5.625 7.875 N LDB2 n/a
4 TRCN0000021807 CCGTTACTTTAGCACTGTGTT pLKO.1 674 CDS 100% 4.950 6.930 N LDB2 n/a
5 TRCN0000095706 GAAAGGCTAATCACTAGATTA pLKO.1 1359 CDS 100% 1.320 1.848 N Ldb2 n/a
6 TRCN0000430136 CCGTGGGTGATCATTACAATT pLKO_005 1566 3UTR 100% 13.200 10.560 N LDB2 n/a
7 TRCN0000423555 GGAACTGATGTCGAGACATAA pLKO_005 1058 CDS 100% 13.200 10.560 N LDB2 n/a
8 TRCN0000437900 AGCACGGGAAGCCCATGTTTA pLKO_005 799 CDS 100% 13.200 9.240 N LDB2 n/a
9 TRCN0000271810 AGCCAGAGTACCGAATCTATG pLKO_005 382 CDS 100% 10.800 7.560 N Ldb2 n/a
10 TRCN0000021808 CCGCCACTCAAGAGACCAAAT pLKO.1 1480 CDS 100% 10.800 7.560 N LDB2 n/a
11 TRCN0000021806 CCGAATCTATGAGATGAACAA pLKO.1 392 CDS 100% 4.950 3.465 N LDB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713977.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.