Transcript: Human XM_006714081.3

PREDICTED: Homo sapiens lin-54 DREAM MuvB core complex component (LIN54), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIN54 (132660)
Length:
5505
CDS:
119..2368

Additional Resources:

NCBI RefSeq record:
XM_006714081.3
NBCI Gene record:
LIN54 (132660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714081.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107669 CCCAATGTCCAGCAGATTCAA pLKO.1 1154 CDS 100% 5.625 7.875 N LIN54 n/a
2 TRCN0000436288 CACCTTTGAAATCGCCAAATA pLKO_005 1047 CDS 100% 13.200 9.240 N LIN54 n/a
3 TRCN0000107665 GCAGACAGAATGTTACATAAA pLKO.1 2777 3UTR 100% 13.200 9.240 N LIN54 n/a
4 TRCN0000095106 GCTTCCATTCAATGGCATAAT pLKO.1 1636 CDS 100% 13.200 9.240 N Lin54 n/a
5 TRCN0000433888 GTCATAGCAAAGGGTGTAATT pLKO_005 1899 CDS 100% 13.200 9.240 N LIN54 n/a
6 TRCN0000422114 ACTCTACAGCCACGCCCATTT pLKO_005 282 CDS 100% 10.800 7.560 N LIN54 n/a
7 TRCN0000107668 GCCTAAGATAGGGAAAGGAAA pLKO.1 1858 CDS 100% 4.950 3.465 N LIN54 n/a
8 TRCN0000107666 CCTGTGACTATATCAGCCAAT pLKO.1 437 CDS 100% 4.050 2.835 N LIN54 n/a
9 TRCN0000107667 CGGCTTCCATTCAATGGCATA pLKO.1 1634 CDS 100% 4.050 2.835 N LIN54 n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5072 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000073413 CGCCTGTAATTCCAGCACTTT pLKO.1 4994 3UTR 100% 4.950 2.475 Y LILRB1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3562 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3562 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714081.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.