Transcript: Human XM_006714288.4

PREDICTED: Homo sapiens hedgehog interacting protein (HHIP), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HHIP (64399)
Length:
3030
CDS:
523..2571

Additional Resources:

NCBI RefSeq record:
XM_006714288.4
NBCI Gene record:
HHIP (64399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714288.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372392 TAGACATCCCACTGATATAAA pLKO_005 1836 CDS 100% 15.000 21.000 N HHIP n/a
2 TRCN0000130702 CTACGTGTTTGGAGATCGTAA pLKO.1 2046 CDS 100% 4.950 6.930 N HHIP n/a
3 TRCN0000378715 ACACTTGCCGAGGCCATATTC pLKO_005 971 CDS 100% 13.200 9.240 N HHIP n/a
4 TRCN0000098151 CCGAACAAGTGCCTCTGTAAA pLKO.1 2476 CDS 100% 13.200 9.240 N Hhip n/a
5 TRCN0000127533 CTTGGTCCTCAATGTGAACAA pLKO.1 2506 CDS 100% 4.950 3.465 N HHIP n/a
6 TRCN0000127693 GCTTCTTTGAAGGAGATGCTA pLKO.1 572 CDS 100% 3.000 2.100 N HHIP n/a
7 TRCN0000130775 GATACTGTGTTCAGACTCCAA pLKO.1 1869 CDS 100% 2.640 1.848 N HHIP n/a
8 TRCN0000127742 GCCATTCAGTAATGGTCCTTT pLKO.1 1974 CDS 100% 0.495 0.347 N HHIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714288.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.